zgc:92763

Ensembl ID:
ENSDARG00000056510
ZFIN ID:
ZDB-GENE-040718-298
Description:
hypothetical protein LOC436833 [Source:RefSeq peptide;Acc:NP_001002560]
Human Orthologue:
GSTK1
Human Description:
glutathione S-transferase kappa 1 [Source:HGNC Symbol;Acc:16906]
Mouse Orthologue:
Gstk1
Mouse Description:
glutathione S-transferase kappa 1 Gene [Source:MGI Symbol;Acc:MGI:1923513]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36187 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32099 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36187
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030282 Essential Splice Site 94 229 4 8
ENSDART00000130111 Essential Splice Site 94 229 3 14
ENSDART00000138701 Essential Splice Site 94 167 4 6

The following transcripts of ENSDARG00000056510 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 34326027)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32057527
GRCz11 16 32011557
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTCCTGTGCGTCAACCTTCCAACGTTTTTGAGACAATGTTTGAGAAAG[G/A]TATTTACAGAACAAGTCATACGTTTTATGTATAGAAAATTAACGTTTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32099
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030282   None 229 None 8
ENSDART00000130111 Essential Splice Site None 229 11 14
ENSDART00000138701   None 167 None 6

The following transcripts of ENSDARG00000056510 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 34320031)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32051531
GRCz11 16 32005561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGTGGAGCACTCATCAGGACATAGTCCAGCCTGCCTCACTCACAGAG[G/A]TATGCTATGCTCATGATGATTACAAATTTAATCAAGATTAGGCGTGTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link