zgc:112426

Ensembl ID:
ENSDARG00000056504
ZFIN ID:
ZDB-GENE-050417-324
Description:
protein FRG1 [Source:RefSeq peptide;Acc:NP_001017793]
Human Orthologues:
AL592183.1, CU459211.2, FRG1, FRG1B
Human Descriptions:
FSHD region gene 1 family, member B [Source:HGNC Symbol;Acc:15792]
FSHD region gene 1 [Source:HGNC Symbol;Acc:3954]
Mouse Orthologue:
Frg1
Mouse Description:
FSHD region gene 1 Gene [Source:MGI Symbol;Acc:MGI:893597]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39578 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39578
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079001 Nonsense 206 255 7 9
Genomic Location (Zv9):
Chromosome 1 (position 15418007)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15983175
GRCz11 1 16676112
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATATTGCAGATGAAGACCGAGGCGATGTCAAGAACTGCGAGCTCAATTA[T/A]GTGTGAGTGTCTACATTTATTACATTCAGAAGCGCTGCTGTTCATTCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link