zgc:110158

Ensembl ID:
ENSDARG00000056490
ZFIN ID:
ZDB-GENE-050522-195
Human Orthologues:
AP002414.1, SSBP4
Human Description:
single stranded DNA binding protein 4 [Source:HGNC Symbol;Acc:15676]
Mouse Orthologue:
Ssbp4
Mouse Description:
single stranded DNA binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1924150]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38349 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38349
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004816 Essential Splice Site 145 293 7 14
ENSDART00000138822 Essential Splice Site 117 265 6 13

The following transcripts of ENSDARG00000056490 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 41514375)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 41743943
GRCz11 2 41593283
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTAACCTTCTCTTGTTTTTTTTGTTCTTTTTGTCCCCCTTCTCCTCAC[A/T]GGGGTCCTGGAGGACGTGGCCCGTGGCCGAACCCCAACGCTAACTCTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link