ssbp4

Ensembl ID:
ENSDARG00000056483
ZFIN ID:
ZDB-GENE-030131-469
Description:
single-stranded DNA binding protein like [Source:RefSeq peptide;Acc:NP_001018403]
Human Orthologues:
AP002414.1, SSBP4
Human Description:
single stranded DNA binding protein 4 [Source:HGNC Symbol;Acc:15676]
Mouse Orthologue:
Ssbp4
Mouse Description:
single stranded DNA binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1924150]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24160 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24160
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064902 Essential Splice Site 305 358 14 17
ENSDART00000133982 Essential Splice Site 332 385 15 18
Genomic Location (Zv9):
Chromosome 22 (position 21280189)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20934865
GRCz11 22 20959843
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGGGGGGAATGGGAGCGATGGAGCCGCATCATATGAATGGGTCTTTAG[G/A]TGAGACATCGCCATTTAAATAGCCAATATTATTTACAGTAGTAAAGGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link