zgc:86773

Ensembl ID:
ENSDARG00000056479
ZFIN ID:
ZDB-GENE-040625-133
Description:
hypothetical protein LOC415219 [Source:RefSeq peptide;Acc:NP_001002129]
Human Orthologue:
RAB1A
Human Description:
RAB1A, member RAS oncogene family [Source:HGNC Symbol;Acc:9758]
Mouse Orthologue:
Rab1
Mouse Description:
RAB1, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:97842]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24876 Essential Splice Site Mutation detected in F1 DNA During 2018
sa27623 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16382 Essential Splice Site Available for shipment Available now
sa991 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24876
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078980 Essential Splice Site 137 201 5 6
ENSDART00000100289 Essential Splice Site 99 163 4 5
Genomic Location (Zv9):
Chromosome 10 (position 27565561)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26968355
GRCz11 10 26930068
KASP Assay ID:
554-7365.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAGTGTGACCTGACTACAAAAAAGGTTGTGGACTACACTACCGCTAAG[G/A]TTGGTTGGTAGGGAAATAGACTGGTTAATTGCTTGGTTATTCCAAATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27623
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078980 Essential Splice Site 137 201 5 6
ENSDART00000100289 Essential Splice Site 99 163 4 5
Genomic Location (Zv9):
Chromosome 10 (position 27565562)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26968356
GRCz11 10 26930069
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGTGTGACCTGACTACAAAAAAGGTTGTGGACTACACTACCGCTAAGG[T/G]TGGTTGGTAGGGAAATAGACTGGTTAATTGCTTGGTTATTCCAAATTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16382
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078980 Essential Splice Site 138 201 6 6
ENSDART00000100289 Essential Splice Site 100 163 5 5
Genomic Location (Zv9):
Chromosome 10 (position 27567859)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26970653
GRCz11 10 26932366
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAATTTGATGTAAAGTAACTNNAAACACAAAATTCYTCTCTCTCCWCA[G/A]GAATTTGCTGACTCTCYTGGCATCCCTTTCCTTGAGACGAGTGCCAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa991
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078980 Nonsense 195 201 6 6
ENSDART00000100289 Nonsense 157 163 5 5
Genomic Location (Zv9):
Chromosome 10 (position 27568031)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26970825
GRCz11 10 26932538
KASP Assay ID:
554-0895.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGGGGCTCTGAGAAACCTGACCTTAAAATCGAAAGCACCCCGGTGCAA[C/T]AGTCAGGCGGCGGCTGCTGTTAGAAAACTCTTGTTTTCTCAGGGAGAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link