zgc:153096

Ensembl ID:
ENSDARG00000056453
ZFIN ID:
ZDB-GENE-061013-428
Description:
actin filament associated protein 1-like [Source:RefSeq peptide;Acc:NP_001070755]
Human Orthologue:
AFAP1L1
Human Description:
actin filament associated protein 1-like 1 [Source:HGNC Symbol;Acc:26714]
Mouse Orthologue:
Afap1l1
Mouse Description:
actin filament associated protein 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:2147199]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44971 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44971
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078949 Essential Splice Site 307 754 8 19
ENSDART00000078953   None 210 None 8
ENSDART00000122122 Essential Splice Site 308 756 8 21
Genomic Location (Zv9):
Chromosome 21 (position 29180283)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30399527
GRCz11 21 30436222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTAGTACTGGCTGTACAGAGCAAAGAACAGGCCGAGAGCTGGCTAAAG[G/A]TGCTGCACCACAGCATATAATGTACTATCACAGCACGCAATGTACTATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link