
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
sf3a3
- Ensembl ID:
- ENSDARG00000056447
- ZFIN ID:
- ZDB-GENE-040908-1
- Description:
- splicing factor 3A subunit 3 [Source:RefSeq peptide;Acc:NP_001004289]
- Human Orthologue:
- SF3A3
- Human Description:
- splicing factor 3a, subunit 3, 60kDa [Source:HGNC Symbol;Acc:10767]
- Mouse Orthologue:
- Sf3a3
- Mouse Description:
- splicing factor 3a, subunit 3 Gene [Source:MGI Symbol;Acc:MGI:1922312]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12602 | Nonsense | Available for shipment | Available now |
sa39239 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa43249 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa18610 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12602
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000078924 | Nonsense | 138 | 501 | 7 | 19 |
ENSDART00000141102 | Nonsense | 56 | 419 | 3 | 14 |
- Genomic Location (Zv9):
- Chromosome 19 (position 16735089)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 17398693 GRCz11 19 17303055 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTATGTGATTATAGACTTKGTGGAGTTCACTGATGAAGAGGGTTATGGG[C/T]GATACCTGGATCTCCATGACTGCTACCTAAAATATATTAATCTAAAAGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39239
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000078924 | Essential Splice Site | 156 | 501 | 7 | 19 |
ENSDART00000141102 | Essential Splice Site | 74 | 419 | 3 | 14 |
- Genomic Location (Zv9):
- Chromosome 19 (position 16735032)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 17398636 GRCz11 19 17302998 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGATCTCCATGACTGCTACCTAAAATATATTAATCTAAAAGGAGTAGAG[G/A]TACAGCCTGACATCTTTGAATTGATTATCTCTAAAGAAGTAAACCAAATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43249
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000078924 | Nonsense | 206 | 501 | 9 | 19 |
ENSDART00000141102 | Nonsense | 124 | 419 | 5 | 14 |
- Genomic Location (Zv9):
- Chromosome 19 (position 16734462)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 17398066 GRCz11 19 17302428 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTTGGAGTACCTGCAGGAATACACAGATCGCGTCAAGCCTTTGCTGGAT[C/T]AGAATGAGCTGTATGGAAAGATTTTGGCAGAGTTTGAGAAGAAGTGGGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18610
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000078924 | Essential Splice Site | 458 | 501 | 17 | 19 |
ENSDART00000141102 | Essential Splice Site | 376 | 419 | 13 | 14 |
- Genomic Location (Zv9):
- Chromosome 19 (position 16725593)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 17389197 GRCz11 19 17293559 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAGACCCATCTGGATGGTTATTTATATTTAATTNNNNGTTTGTTTCTCTGCAAT[A/C]GTGTGGTCAAAACTGAAGTCACAGAAAGCATTGGAGCGATGGCAGCCTGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: