usp1

Ensembl ID:
ENSDARG00000056414
ZFIN ID:
ZDB-GENE-030131-726
Description:
ubiquitin carboxyl-terminal hydrolase 1 [Source:RefSeq peptide;Acc:NP_955873]
Human Orthologue:
USP1
Human Description:
ubiquitin specific peptidase 1 [Source:HGNC Symbol;Acc:12607]
Mouse Orthologue:
Usp1
Mouse Description:
ubiquitin specific peptidase 1 Gene [Source:MGI Symbol;Acc:MGI:2385198]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40721 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40721
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078908 Nonsense 636 772 9 9
ENSDART00000126242 Nonsense 636 772 8 9
ENSDART00000133162 Nonsense 339 475 4 4
Genomic Location (Zv9):
Chromosome 6 (position 32098121)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 32419037
GRCz11 6 32405951
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCGACTATGATGATGGCGAGGTGTCCTTCAGCTTGTCTGGCAGAGGG[C/T]GAAATGTGGCCAGAACCAGCGGAACTAATAACATGTCCAGCAAAACGGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link