wacb

Ensembl ID:
ENSDARG00000056403
ZFIN ID:
ZDB-GENE-041010-46
Description:
WW domain containing adaptor with coiled-coil b [Source:RefSeq peptide;Acc:NP_001005971]
Human Orthologue:
WAC
Human Description:
WW domain containing adaptor with coiled-coil [Source:HGNC Symbol;Acc:17327]
Mouse Orthologue:
Wac
Mouse Description:
WW domain containing adaptor with coiled-coil Gene [Source:MGI Symbol;Acc:MGI:2387357]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10649 Essential Splice Site Available for shipment Available now
sa17642 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10649
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012531 Essential Splice Site 338 494 10 14
ENSDART00000098384   None 155 None 3
ENSDART00000012531 Essential Splice Site 338 494 10 14
ENSDART00000098384   None 155 None 3
Genomic Location (Zv9):
Chromosome 2 (position 3082268)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 4554421
GRCz11 2 4395046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTCTCTAAACCCCTGCTCAGCTCYGCATCKCTCTCTTCACAACCAAAGG[T/G]CAGTAGCAGAGGTCAATGGGTCATTTTCAAAGATATTAAAGTGGTCTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17642
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012531 Essential Splice Site 338 494 10 14
ENSDART00000098384   None 155 None 3
ENSDART00000012531 Essential Splice Site 338 494 10 14
ENSDART00000098384   None 155 None 3
Genomic Location (Zv9):
Chromosome 2 (position 3082268)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 4554421
GRCz11 2 4395046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTCTCTAAACCCCTGCTCAGCTCYGCATCKCTCTCTTCACAACCAAAGG[T/G]CAGTAGCAGAGGTCAATGGGTCATTTTCAAAGATATTAAAGTGGTCTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link