zgc:85910

Ensembl ID:
ENSDARG00000056381
ZFIN ID:
ZDB-GENE-030131-9405
Description:
hypothetical protein LOC337459 [Source:RefSeq peptide;Acc:NP_997943]
Human Orthologue:
KIAA1430
Human Description:
KIAA1430 [Source:HGNC Symbol;Acc:29276]
Mouse Orthologue:
4933411K20Rik
Mouse Description:
RIKEN cDNA 4933411K20 gene Gene [Source:MGI Symbol;Acc:MGI:1914006]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39584 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39584
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078874 Essential Splice Site 420 449 3 4
ENSDART00000146258 Essential Splice Site 420 449 4 5
Genomic Location (Zv9):
Chromosome 1 (position 16425076)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16990244
GRCz11 1 17683181
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGGAACACATAATACAGACATTCCACTGGTCAACCCCAAGACTTCTGG[T/C]ATGTGTGCACACACACACACTTTAAATGATGATGTCACATTCAGTTATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link