A9JRY9_DANRE

Ensembl ID:
ENSDARG00000056374
Description:
LOC561765 protein [Source:UniProtKB/TrEMBL;Acc:A9JRY9]
Human Orthologue:
NOXO1
Human Description:
NADPH oxidase organizer 1 [Source:HGNC Symbol;Acc:19404]
Mouse Orthologue:
Noxo1
Mouse Description:
NADPH oxidase organizer 1 Gene [Source:MGI Symbol;Acc:MGI:1919143]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35254 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35254
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078860 Essential Splice Site 261 493 6 8
Genomic Location (Zv9):
Chromosome 12 (position 19476648)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18328809
GRCz11 12 18450683
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGAAGAGGAAGAGGATGAGGATGAGTATAACTCAGTGACCTGTGAAAG[T/C]AAGCCACGGTAGTTGCATAAACTTTCTGCCATTATGAATCTCTCAATATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link