zgc:153917

Ensembl ID:
ENSDARG00000056346
ZFIN ID:
ZDB-GENE-070112-1242
Description:
centaurin beta 1-like [Source:RefSeq peptide;Acc:NP_001074048]
Human Orthologue:
ACAP1
Human Description:
ArfGAP with coiled-coil, ankyrin repeat and PH domains 1 [Source:HGNC Symbol;Acc:16467]
Mouse Orthologue:
Acap1
Mouse Description:
ArfGAP with coiled-coil, ankyrin repeat and PH domains 1 Gene [Source:MGI Symbol;Acc:MGI:2388270]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30628 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9629 Nonsense Available for shipment Available now
sa26928 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30628
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052902 Essential Splice Site 95 757 5 24
ENSDART00000121993 Essential Splice Site 95 772 4 24
ENSDART00000142891 Essential Splice Site 96 115 6 7
Genomic Location (Zv9):
Chromosome 7 (position 21247440)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19837876
GRCz11 7 20089844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGAAAAGTTTTCTAAAAAGCTGTCAGCCATTGTTAGTGCTCAAGAGG[T/G]GAGTTGAGTTCTTCCTTTCTTTTTACTGTCACTGTTACTATAGTAACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9629
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052902 Nonsense 478 757 17 24
ENSDART00000121993 Nonsense 478 772 16 24
ENSDART00000142891   None 115 None 7
Genomic Location (Zv9):
Chromosome 7 (position 21230748)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19821184
GRCz11 7 20073152
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTTCAGCTCATGTGTGAATTAGGAAACACAGCRATTAACAAGATCTA[T/A]GAGGCGCGTATTGAAGAGATCACAATCAAGAAGCCTCAYCCCTCTAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26928
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052902 Essential Splice Site 560 757 18 24
ENSDART00000121993 Essential Splice Site 560 772 17 24
ENSDART00000142891   None 115 None 7
Genomic Location (Zv9):
Chromosome 7 (position 21230401)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19820837
GRCz11 7 20072805
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGCCCTTAAACCCAAACCCGGCAGGGTCACACTGCCACGACTCACCG[G/A]TACACACGAACACTGTTTGATTTCAAAGATTTCATAAACTGAAATGAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link