
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:153917
- Ensembl ID:
- ENSDARG00000056346
- ZFIN ID:
- ZDB-GENE-070112-1242
- Description:
- centaurin beta 1-like [Source:RefSeq peptide;Acc:NP_001074048]
- Human Orthologue:
- ACAP1
- Human Description:
- ArfGAP with coiled-coil, ankyrin repeat and PH domains 1 [Source:HGNC Symbol;Acc:16467]
- Mouse Orthologue:
- Acap1
- Mouse Description:
- ArfGAP with coiled-coil, ankyrin repeat and PH domains 1 Gene [Source:MGI Symbol;Acc:MGI:2388270]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa30628 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa9629 | Nonsense | Available for shipment | Available now |
sa26928 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa30628
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052902 | Essential Splice Site | 95 | 757 | 5 | 24 |
ENSDART00000121993 | Essential Splice Site | 95 | 772 | 4 | 24 |
ENSDART00000142891 | Essential Splice Site | 96 | 115 | 6 | 7 |
- Genomic Location (Zv9):
- Chromosome 7 (position 21247440)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 19837876 GRCz11 7 20089844 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTAGAAAAGTTTTCTAAAAAGCTGTCAGCCATTGTTAGTGCTCAAGAGG[T/G]GAGTTGAGTTCTTCCTTTCTTTTTACTGTCACTGTTACTATAGTAACCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9629
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052902 | Nonsense | 478 | 757 | 17 | 24 |
ENSDART00000121993 | Nonsense | 478 | 772 | 16 | 24 |
ENSDART00000142891 | None | 115 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 7 (position 21230748)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 19821184 GRCz11 7 20073152 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTCTTCAGCTCATGTGTGAATTAGGAAACACAGCRATTAACAAGATCTA[T/A]GAGGCGCGTATTGAAGAGATCACAATCAAGAAGCCTCAYCCCTCTAGTCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa26928
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052902 | Essential Splice Site | 560 | 757 | 18 | 24 |
ENSDART00000121993 | Essential Splice Site | 560 | 772 | 17 | 24 |
ENSDART00000142891 | None | 115 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 7 (position 21230401)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 19820837 GRCz11 7 20072805 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCTGCCCTTAAACCCAAACCCGGCAGGGTCACACTGCCACGACTCACCG[G/A]TACACACGAACACTGTTTGATTTCAAAGATTTCATAAACTGAAATGAAAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: