STK31

Ensembl ID:
ENSDARG00000056339
Description:
serine/threonine kinase 31 [Source:HGNC Symbol;Acc:11407]
Human Orthologue:
STK31
Human Description:
serine/threonine kinase 31 [Source:HGNC Symbol;Acc:11407]
Mouse Orthologue:
Stk31
Mouse Description:
serine threonine kinase 31 Gene [Source:MGI Symbol;Acc:MGI:1924735]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44850 Nonsense Mutation detected in F1 DNA During 2018
sa7421 Missense Mutation detected in F1 DNA During 2018
sa36102 Essential Splice Site Mutation detected in F1 DNA During 2018
sa22819 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa44850
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078790 Nonsense 86 977 5 24
Genomic Location (Zv9):
Chromosome 16 (position 23618574)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21728325
GRCz11 16 21533361
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACACTGAAAATTGTTTTTGTTTTTTTTGTCTTATTCTGCCTAGTTCTA[T/A]ATTCTCTACATTGACTTTGGAAATATGGAGATTGTCAGTCGATCTGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7421
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078790 Missense 493 977 12 24
Genomic Location (Zv9):
Chromosome 16 (position 23604084)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21713835
GRCz11 16 21519084
KASP Assay ID:
554-4180.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCATCGTTGACWGCAGTATTTAGCTCTGTTATGCTGCCGGAGCAGATC[G/C]ATGASTACGCGTTTGAAAAATTCTGTGAGTGGAAAAGAMACAAACAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36102
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078790 Essential Splice Site 574 977 14 24
Genomic Location (Zv9):
Chromosome 16 (position 23600273)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21710024
GRCz11 16 21515271
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTACTGTTACTCAATTGGAAAAATATGTTTTACACTTTTGCTTTCACA[G/A]AAACAAAACAACCAAGACAGGAAAATAGTGTTTAATGCCTTTCTCAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22819
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078790 Essential Splice Site 719 977 18 24
Genomic Location (Zv9):
Chromosome 16 (position 23595056)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21704807
GRCz11 16 21510016
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTAGGACAGAGATATTTGTTTTTTATTTTACTACATGTGTTTGCTTTC[A/T]GAGCTCTGCAGGGCTGTTAGTGAAGAGCTTGGACAGAGACATGTTTGACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link