zgc:109926

Ensembl ID:
ENSDARG00000056338
ZFIN ID:
ZDB-GENE-050522-55
Description:
UPF0485 protein C1orf144 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q504E7]
Human Orthologue:
C1orf144
Human Description:
chromosome 1 open reading frame 144 [Source:HGNC Symbol;Acc:30232]
Mouse Orthologue:
D4Ertd22e
Mouse Description:
DNA segment, Chr 4, ERATO Doi 22, expressed Gene [Source:MGI Symbol;Acc:MGI:1098672]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24333 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24333
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078824 Nonsense 104 161 3 4

The following transcripts of ENSDARG00000056338 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 24791906)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24578026
GRCz11 23 24504567
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAAGTGAAATCCTTAGCTCAGCGAGAGGCAGAATACGCAGAGGCCAGG[A/T]AGAGAATCCTCGGCAGTGCAACTCCTGATGACACGCCACAGGAGAGACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link