si:dkey-31b16.12

Ensembl ID:
ENSDARG00000056334
ZFIN ID:
ZDB-GENE-060810-45
Human Orthologue:
MLH3
Human Description:
mutL homolog 3 (E. coli) [Source:HGNC Symbol;Acc:7128]
Mouse Orthologue:
Mlh3
Mouse Description:
mutL homolog 3 (E coli) Gene [Source:MGI Symbol;Acc:MGI:1353455]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37705 Nonsense Available for shipment Available now
sa15701 Essential Splice Site Available for shipment Available now
sa24334 Essential Splice Site Available for shipment Available now
sa24335 Nonsense Available for shipment Available now
sa226 Nonsense Confirmed mutation in F2 line During 2018
sa9704 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37705
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078805 Nonsense 645 1133 1 12
ENSDART00000143694 Nonsense 645 1171 1 11
Genomic Location (Zv9):
Chromosome 23 (position 24878904)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24665024
GRCz11 23 24591565
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAGATTCAAACTTCCTTAAACGGGACCTTTCATCTTTCCCACCCTCA[C/T]AAGACTCATGCTTTAAAGAATTAGAAAAAACCCTCTTAGATGAAGATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15701
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078805 Essential Splice Site 827 1133 2 12
ENSDART00000143694 Essential Splice Site 854 1171 1 11
Genomic Location (Zv9):
Chromosome 23 (position 24879535)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24665655
GRCz11 23 24592196
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCAAGCCCAGAGCAGAAAGAGCCTTTAACTCMGGGAYAGACAGCAGAG[G/A]TACAGCTCTAGACTGACATAAGGCCTGAAATCAGCTTTTCGGTGCACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24334
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078805 Essential Splice Site 828 1133 3 12
ENSDART00000143694 Essential Splice Site 855 1171 2 11
Genomic Location (Zv9):
Chromosome 23 (position 24879615)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24665735
GRCz11 23 24592276
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGCTTTTCGGTGCACTTTAACTAATTGTTTTTTTTGTTACTCTTTAA[G/A]AGGATGCCCAAGCTCCCGATTCACTGTCGACTTTATTCTCAGAATGGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24335
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078805 Nonsense 850 1133 3 12
ENSDART00000143694 Nonsense 877 1171 2 11
Genomic Location (Zv9):
Chromosome 23 (position 24879681)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24665801
GRCz11 23 24592342
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGATTCACTGTCGACTTTATTCTCAGAATGGCACAACCCTGTGTTTATA[C/T]GACCACCAGAGGTAAAAAGTACTGAGTAAAATAGTGTGTGTATTAGGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa226
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078805 Nonsense 900 1133 5 12
ENSDART00000143694 Nonsense 927 1171 4 11
Genomic Location (Zv9):
Chromosome 23 (position 24881849)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24667969
GRCz11 23 24594510
KASP Assay ID:
554-0160.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTTTACCCTTAGGTCATCAATCAAGTAGACAAGAAGTTTCTTGCTTG[T/A]TTGATAAATACAGCAGGGCAGAACACCTCTGAAAGCAGTACGGATGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9704
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078805 Nonsense 911 1133 5 12
ENSDART00000143694 Nonsense 938 1171 4 11
Genomic Location (Zv9):
Chromosome 23 (position 24881880)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24668000
GRCz11 23 24594541
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAGAAGTTTCTTGCTTGTTTGATAAATACAGCAGGGCAGAACACCTCT[G/T]AAAGCAGTACGGATGAAGGTATTGTGGGCTGAAAATCACAATGTTRAATR
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link