
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-31b16.12
- Ensembl ID:
- ENSDARG00000056334
- ZFIN ID:
- ZDB-GENE-060810-45
- Human Orthologue:
- MLH3
- Human Description:
- mutL homolog 3 (E. coli) [Source:HGNC Symbol;Acc:7128]
- Mouse Orthologue:
- Mlh3
- Mouse Description:
- mutL homolog 3 (E coli) Gene [Source:MGI Symbol;Acc:MGI:1353455]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa37705 | Nonsense | Available for shipment | Available now |
sa15701 | Essential Splice Site | Available for shipment | Available now |
sa24334 | Essential Splice Site | Available for shipment | Available now |
sa24335 | Nonsense | Available for shipment | Available now |
sa226 | Nonsense | Confirmed mutation in F2 line | During 2018 |
sa9704 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa37705
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000078805 | Nonsense | 645 | 1133 | 1 | 12 |
ENSDART00000143694 | Nonsense | 645 | 1171 | 1 | 11 |
- Genomic Location (Zv9):
- Chromosome 23 (position 24878904)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 24665024 GRCz11 23 24591565 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCAGAGATTCAAACTTCCTTAAACGGGACCTTTCATCTTTCCCACCCTCA[C/T]AAGACTCATGCTTTAAAGAATTAGAAAAAACCCTCTTAGATGAAGATGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15701
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000078805 | Essential Splice Site | 827 | 1133 | 2 | 12 |
ENSDART00000143694 | Essential Splice Site | 854 | 1171 | 1 | 11 |
- Genomic Location (Zv9):
- Chromosome 23 (position 24879535)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 24665655 GRCz11 23 24592196 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCCCAAGCCCAGAGCAGAAAGAGCCTTTAACTCMGGGAYAGACAGCAGAG[G/A]TACAGCTCTAGACTGACATAAGGCCTGAAATCAGCTTTTCGGTGCACTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24334
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000078805 | Essential Splice Site | 828 | 1133 | 3 | 12 |
ENSDART00000143694 | Essential Splice Site | 855 | 1171 | 2 | 11 |
- Genomic Location (Zv9):
- Chromosome 23 (position 24879615)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 24665735 GRCz11 23 24592276 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCAGCTTTTCGGTGCACTTTAACTAATTGTTTTTTTTGTTACTCTTTAA[G/A]AGGATGCCCAAGCTCCCGATTCACTGTCGACTTTATTCTCAGAATGGCAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24335
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000078805 | Nonsense | 850 | 1133 | 3 | 12 |
ENSDART00000143694 | Nonsense | 877 | 1171 | 2 | 11 |
- Genomic Location (Zv9):
- Chromosome 23 (position 24879681)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 24665801 GRCz11 23 24592342 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCGATTCACTGTCGACTTTATTCTCAGAATGGCACAACCCTGTGTTTATA[C/T]GACCACCAGAGGTAAAAAGTACTGAGTAAAATAGTGTGTGTATTAGGGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa226
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000078805 | Nonsense | 900 | 1133 | 5 | 12 |
ENSDART00000143694 | Nonsense | 927 | 1171 | 4 | 11 |
- Genomic Location (Zv9):
- Chromosome 23 (position 24881849)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 24667969 GRCz11 23 24594510 - KASP Assay ID:
- 554-0160.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGTTTTACCCTTAGGTCATCAATCAAGTAGACAAGAAGTTTCTTGCTTG[T/A]TTGATAAATACAGCAGGGCAGAACACCTCTGAAAGCAGTACGGATGAAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9704
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000078805 | Nonsense | 911 | 1133 | 5 | 12 |
ENSDART00000143694 | Nonsense | 938 | 1171 | 4 | 11 |
- Genomic Location (Zv9):
- Chromosome 23 (position 24881880)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 24668000 GRCz11 23 24594541 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACAAGAAGTTTCTTGCTTGTTTGATAAATACAGCAGGGCAGAACACCTCT[G/T]AAAGCAGTACGGATGAAGGTATTGTGGGCTGAAAATCACAATGTTRAATR
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: