zgc:153067

Ensembl ID:
ENSDARG00000056330
ZFIN ID:
ZDB-GENE-060929-1166
Description:
hypothetical protein LOC767810 [Source:RefSeq peptide;Acc:NP_001070245]
Human Orthologues:
HLA-DOB, HLA-DPB1, HLA-DPB2, HLA-DQB1, HLA-DQB2, HLA-DRB1, HLA-DRB5
Human Descriptions:
major histocompatibility complex, class II, DO beta [Source:HGNC Symbol;Acc:4937]
major histocompatibility complex, class II, DP beta 1 [Source:HGNC Symbol;Acc:4940]
major histocompatibility complex, class II, DP beta 2 (pseudogene) [Source:HGNC Symbol;Acc:4941]
major histocompatibility complex, class II, DQ beta 1 [Source:HGNC Symbol;Acc:4944]
major histocompatibility complex, class II, DQ beta 2 [Source:HGNC Symbol;Acc:4945]
major histocompatibility complex, class II, DR beta 1 [Source:HGNC Symbol;Acc:4948]
major histocompatibility complex, class II, DR beta 5 [Source:HGNC Symbol;Acc:4953]
Mouse Orthologues:
H2-Ab1, H2-Eb1, H2-Eb2, H2-Ob
Mouse Descriptions:
histocompatibility 2, class II antigen A, beta 1 Gene [Source:MGI Symbol;Acc:MGI:103070]
histocompatibility 2, class II antigen E beta Gene [Source:MGI Symbol;Acc:MGI:95901]
histocompatibility 2, class II antigen E beta2 Gene [Source:MGI Symbol;Acc:MGI:95902]
histocompatibility 2, O region beta locus Gene [Source:MGI Symbol;Acc:MGI:95925]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14347 Nonsense Available for shipment Available now
sa36674 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14347
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099281 Nonsense 38 251 2 5
Genomic Location (Zv9):
Chromosome 18 (position 29874042)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 29946299
GRCz11 18 29924553
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGACATTATGGATTTGTCCAGTTTACCTGCCATATGCTTGGTTCTCTA[C/T]AAAATGTAGAGGTTACATACTCTATCTATTTTGACACAACCGAATTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36674
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099281 Nonsense 132 251 3 5
Genomic Location (Zv9):
Chromosome 18 (position 29873682)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 29945939
GRCz11 18 29924193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCGGTCATTAAGGGAGGCCAGTGGTAAAAGGCCAGCACTGTTGAGCTG[C/A]AGTGCCTATAACTTTTACCCCAAGCACATCAAACTGACGTGGATGAGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link