zgc:123295

Ensembl ID:
ENSDARG00000056324
ZFIN ID:
ZDB-GENE-051127-11
Description:
hypothetical protein LOC641564 [Source:RefSeq peptide;Acc:NP_001032651]
Human Orthologues:
PRSS21, PRSS38, PRSS42, PRSS44, PRSS45, PRSS50
Human Descriptions:
protease, serine, 21 (testisin) [Source:HGNC Symbol;Acc:9485]
protease, serine, 38 [Source:HGNC Symbol;Acc:29625]
protease, serine, 42 [Source:HGNC Symbol;Acc:30716]
protease, serine, 44 [Source:HGNC Symbol;Acc:37324]
protease, serine, 45 [Source:HGNC Symbol;Acc:30717]
protease, serine, 50 [Source:HGNC Symbol;Acc:17910]
Mouse Orthologues:
Prss21, Prss38, Prss41, Prss42, Prss43, Prss44, Prss45, Prss46, Prss50
Mouse Descriptions:
protease, serine, 21 Gene [Source:MGI Symbol;Acc:MGI:1916698]
protease, serine, 38 Gene [Source:MGI Symbol;Acc:MGI:2685095]
protease, serine, 41 Gene [Source:MGI Symbol;Acc:MGI:1918253]
protease, serine, 42 Gene [Source:MGI Symbol;Acc:MGI:2665280]
protease, serine, 43 Gene [Source:MGI Symbol;Acc:MGI:2684822]
protease, serine, 44 Gene [Source:MGI Symbol;Acc:MGI:1920586]
protease, serine, 45 Gene [Source:MGI Symbol;Acc:MGI:3605764]
protease, serine, 46 Gene [Source:MGI Symbol;Acc:MGI:1921556]
protease, serine, 50 Gene [Source:MGI Symbol;Acc:MGI:2447303]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33148 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33148
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078807 Nonsense 285 310 6 6

The following transcripts of ENSDARG00000056324 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 21411277)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21067668
GRCz11 3 21198216
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCAGCAGCAATCCACCTGGATTTGTTGAATTCCATTCCAGTGGATTC[A/T]GAAGCACATCTAACCTGTTTTTATTGTCCATTTCTCTCACATTATCCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link