zgc:103534

Ensembl ID:
ENSDARG00000056318
ZFIN ID:
ZDB-GENE-041010-67
Description:
hypothetical protein LOC449817 [Source:RefSeq peptide;Acc:NP_001005990]
Human Orthologue:
C12orf41
Human Description:
chromosome 12 open reading frame 41 [Source:HGNC Symbol;Acc:26024]
Mouse Orthologues:
2310037I24Rik, Gm4885
Mouse Descriptions:
predicted gene 4885 Pseudogene [Source:MGI Symbol;Acc:MGI:3648525]
RIKEN cDNA 2310037I24 gene Gene [Source:MGI Symbol;Acc:MGI:1916862]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15950 Nonsense Available for shipment Available now
sa17169 Nonsense Available for shipment Available now
sa37706 Nonsense Mutation detected in F1 DNA During 2018
sa17260 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15950
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078796 Nonsense 37 506 2 10
ENSDART00000126510 Nonsense 37 408 2 8
ENSDART00000146332   None 216 None 5

The following transcripts of ENSDARG00000056318 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 24887943)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24674063
GRCz11 23 24600604
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGTGCYCAAGAACCTCAGACCTGCTCGTACACCCAAAGACCGWGTTCA[C/T]AGCCRCGTCTGGAAGGCCTGGAGTTCTGCATCAAACACGTGCYTGAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17169
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078796 Nonsense 118 506 3 10
ENSDART00000126510 Nonsense 118 408 3 8
ENSDART00000146332   None 216 None 5

The following transcripts of ENSDARG00000056318 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 24888276)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24674396
GRCz11 23 24600937
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAATRCGGAAAGCAWYYGCTTCGGGACCGTCCCCTGAAGTCCTGCTCT[C/A]GCAGCTGAGYGGCTACAGTCGGCCTGAACCTGGAGCTCACAGTCAAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37706
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078796 Nonsense 281 506 6 10
ENSDART00000126510 Nonsense 281 408 6 8
ENSDART00000146332   None 216 None 5

The following transcripts of ENSDARG00000056318 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 24891789)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24677909
GRCz11 23 24604450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGGCGTCGTTATGGTGTGGAGGCTTTGCTGCACCGTCAGCTCAGAGAA[C/T]GAAGACAAGCAATCACTGAAGGAGGACCGACACAGGTATGGATGGACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17260
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078796 Nonsense 394 506 8 10
ENSDART00000126510 Nonsense 394 408 8 8
ENSDART00000146332 Nonsense 104 216 3 5

The following transcripts of ENSDARG00000056318 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 24894024)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24680144
GRCz11 23 24606685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCGGAGCAGCTGGCGTCTGCGCCCACAGACATGTACCTCAGTGCCGCC[G/T]AGCTCCAGCCAACAGAAAATCTACCKCTGGAATTCAGTGATGTATGATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link