atxn7l2b

Ensembl ID:
ENSDARG00000056268
ZFIN ID:
ZDB-GENE-040718-403
Description:
ataxin 7-like 2b [Source:RefSeq peptide;Acc:NP_001002655]
Human Orthologue:
ATXN7L2
Human Description:
ataxin 7-like 2 [Source:HGNC Symbol;Acc:28713]
Mouse Orthologue:
Atxn7l2
Mouse Description:
ataxin 7-like 2 Gene [Source:MGI Symbol;Acc:MGI:1919772]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38689 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38689
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061580 Nonsense 154 655 3 10
ENSDART00000143922 Nonsense 165 666 3 10
Genomic Location (Zv9):
Chromosome 8 (position 25947321)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25075239
GRCz11 8 25094378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCACGAGTCCCACCACCTCATCCTCCACACCAGGGACGGCCCAAACCA[C/T]AGAGGGAAGCACCCAGGTGAGAAAGAACGAAAAACAGTTGATTTCCGCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link