zgc:101525

Ensembl ID:
ENSDARG00000056262
ZFIN ID:
ZDB-GENE-041114-202
Description:
hypothetical protein LOC492818 [Source:RefSeq peptide;Acc:NP_001007460]
Human Orthologue:
TMEM22
Human Description:
transmembrane protein 22 [Source:HGNC Symbol;Acc:28480]
Mouse Orthologue:
Tmem22
Mouse Description:
transmembrane protein 22 Gene [Source:MGI Symbol;Acc:MGI:2685365]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45102 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45102
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111507 Essential Splice Site 278 304 None 3
ENSDART00000144795   278 415 2 2
Genomic Location (Zv9):
Chromosome 2 (position 24761318)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25336095
GRCz11 2 24991729
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACAGTGATGGCAGGCTTAATGGCGGCCATGTCCATGATCATCTACCG[T/C]GCCATAAAAGAAAGGGTGAGCATGTGGACGGCTCTTTTCACCTTCGGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link