sort1b

Ensembl ID:
ENSDARG00000056252
ZFIN ID:
ZDB-GENE-030131-7447
Description:
sortilin 1b [Source:RefSeq peptide;Acc:NP_001119937]
Human Orthologue:
SORT1
Human Description:
sortilin 1 [Source:HGNC Symbol;Acc:11186]
Mouse Orthologue:
Sort1
Mouse Description:
sortilin 1 Gene [Source:MGI Symbol;Acc:MGI:1338015]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15116 Essential Splice Site, Missense Available for shipment Available now
sa21294 Nonsense Available for shipment Available now
sa41205 Nonsense Mutation detected in F1 DNA During 2018
sa31655 Essential Splice Site Available for shipment Available now
sa34402 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018
sa15853 Essential Splice Site Available for shipment Available now
sa14450 Essential Splice Site Available for shipment Available now
sa21293 Nonsense Available for shipment Available now
sa14735 Essential Splice Site Available for shipment Available now
sa15785 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15116
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078710 Essential Splice Site 10 817 2 21
ENSDART00000134190 Missense 10 828 1 20

The following transcripts of ENSDARG00000056252 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 25927140)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25055058
GRCz11 8 25074197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAATATTCCGAAGACGAAAAATGAGAGGCCTAGGACACTTTATTGCA[C/T]TTTTATTTTTTCCAATGGCATTTGGTGTGGATTTCCATGTGGATCCCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21294
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078710 Nonsense 26 817 2 21
ENSDART00000134190 Nonsense 26 828 1 20

The following transcripts of ENSDARG00000056252 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 25927092)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25055010
GRCz11 8 25074149
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTTTTATTTTTTCCAATGGCATTTGGTGTGGATTTCCATGTGGATCCC[G/T]GATCCTCTAACGCGCACCCGCTGTATGCGAAGTCTCCGGTATCCGTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41205
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078710 Nonsense 84 817 2 21
ENSDART00000134190 Nonsense 84 828 1 20

The following transcripts of ENSDARG00000056252 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 25926917)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25054835
GRCz11 8 25073974
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTCAGACTCATGTAATGGGTTAACGTTAGAAGGATATGAGAGCAAGT[T/A]AACTAGCAATACGCACAACGTAAGTTCACTTGCACCAATGAGCGCAACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31655
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078710 Essential Splice Site 224 817 7 21
ENSDART00000134190 Essential Splice Site 224 828 6 20

The following transcripts of ENSDARG00000056252 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 25915777)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25043695
GRCz11 8 25062834
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTTCTGCTTTTGAACATTTGCATAATTTCTAATTTTACTGCCGTTTC[A/G]GCATGACCTCTGGATCTCGAAAGACTTTGGCACAACATGGACAAAAATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34402
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078710 Essential Splice Site 308 817 None 21
ENSDART00000134190 Missense 309 828 8 20

The following transcripts of ENSDARG00000056252 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 25909121)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25037039
GRCz11 8 25056178
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTGGTGGACGTTTTCTGTTTGCTTCAGTTATGGCAGCATCAGGAAACA[T/G]AATACCGTCGGCATCAGAGGTGTGTGTTATGATACACGAGTGTGTGTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15853
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078710 Essential Splice Site 407 817 11 21
ENSDART00000134190 Essential Splice Site 414 828 10 20

The following transcripts of ENSDARG00000056252 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 25905929)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25033847
GRCz11 8 25052986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAYGTCACTTCMCTCAGAGGAGTCTACACTACTAGTGTGCTARCTGAGGG[T/C]AGGGTATATTCTAGAAAACATGCACATATATTTAAYGTRTGWGTGTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14450
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078710 Essential Splice Site 444 817 None 21
ENSDART00000134190 Essential Splice Site 449 828 None 20

The following transcripts of ENSDARG00000056252 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 25904782)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25032700
GRCz11 8 25051839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAACCAGAAAACACYAAGTGTGATTCCACAGCCAAAGATGCAGAAATGG[T/A]AAGAACCKTGTAAGCAAAGGWGTGATGATKGGACAGATTGGACAGAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21293
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078710 Nonsense 592 817 15 21
ENSDART00000134190 Nonsense 597 828 14 20

The following transcripts of ENSDARG00000056252 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 25900895)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25028813
GRCz11 8 25047952
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTATGAAGACGCTATGATCAGCCACTGGGTCACCTACACTATTGACTTT[A/T]AAGACCTGCTAAAACGAAATTGTAAGTGACCAGTTCAGTTTCAACCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14735
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078710 Essential Splice Site 599 817 16 21
ENSDART00000134190 Essential Splice Site 604 828 15 20

The following transcripts of ENSDARG00000056252 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 25900792)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25028710
GRCz11 8 25047849
KASP Assay ID:
2260-0598.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTGCACTTTATAGTTTAGTTGACACAAACCANTTTTTTGTTTGGTTTTC[A/C]GGCGAGAGTGATGATTATGTTCAATGGCTGGCACACTCTGATGACATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15785
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078710 Essential Splice Site 735 817 None 21
ENSDART00000134190 Essential Splice Site 742 828 None 20

The following transcripts of ENSDARG00000056252 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 25898111)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25026029
GRCz11 8 25045168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGACCTGAGCAAGAGATGCGTCAGTGACCTGCTTGACCCCCAGCCGCTGG[T/C]GAGACTGCATTTATATATCACAGTTCTGCATTTCTGTATTTATAAAAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link