wu:fb15e04

Ensembl ID:
ENSDARG00000056248
ZFIN ID:
ZDB-GENE-030131-8568
Description:
Wu:fb15e04 protein [Source:UniProtKB/TrEMBL;Acc:A7MBP7]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23940 Nonsense Available for shipment Available now
sa5959 Essential Splice Site Mutation detected in F1 DNA During 2018
sa37313 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa23940
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101147 Nonsense 214 603 2 10
Genomic Location (Zv9):
Chromosome 21 (position 24465662)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25151336
GRCz11 21 25187941
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACAATGCAGTACTCAGAGCCAAGATTTCTATGTTTACTAACCCGGAG[C/T]AGGGCGGACCTGCCAACACCTCCGTTCTTCTGACTTCTGCCATCGGGGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5959
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101147 Essential Splice Site 282 603 3 10
Genomic Location (Zv9):
Chromosome 21 (position 24466779)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25152453
GRCz11 21 25189058
KASP Assay ID:
554-3760.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACCTCTCAAACCAAATCTCTGGAGCTTGACTGGACGGCGTTGAAAGAG[G/A]TATGAAACCCCCATCACATGTGATGTCCWCAGAATTACACATGACTGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37313
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101147 Nonsense 309 603 4 10
Genomic Location (Zv9):
Chromosome 21 (position 24466929)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25152603
GRCz11 21 25189208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGCTGCAGACCAGCATCTGTGGTTTGGAGGATCAAATTGCTCTGTCC[A/T]AGCAGGTGTATGATGCTGTGAGTCTACCTCTGATTATTTCAGACACATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link