zgc:171740

Ensembl ID:
ENSDARG00000056244
ZFIN ID:
ZDB-GENE-071004-29
Description:
hypothetical protein LOC795694 [Source:RefSeq peptide;Acc:NP_001103196]
Human Orthologue:
RFFL
Human Description:
ring finger and FYVE-like domain containing 1 [Source:HGNC Symbol;Acc:24821]
Mouse Orthologue:
Rffl
Mouse Description:
ring finger and FYVE like domain containing protein Gene [Source:MGI Symbol;Acc:MGI:1914588]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23938 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23938
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065132 Nonsense 264 271 6 6
ENSDART00000099755 Nonsense 332 339 11 11
Genomic Location (Zv9):
Chromosome 21 (position 24339963)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25025637
GRCz11 21 25062242
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGTGGAAAACGAATGAACGAGTGTCCCATCTGCCGCCAGTATGTGGTT[C/T]GAGCCGTGCACGTCTTCAGATCGTGAAATTTGGGTGCAAAGACACAGATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • QT interval: Common variants at ten loci influence QT interval duration in the QTGEN Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link