zgc:110591

Ensembl ID:
ENSDARG00000056233
ZFIN ID:
ZDB-GENE-050522-510
Description:
Transmembrane protein 179B [Source:UniProtKB/Swiss-Prot;Acc:Q7T392]
Human Orthologue:
TMEM179B
Human Description:
transmembrane protein 179B [Source:HGNC Symbol;Acc:33744]
Mouse Orthologue:
Tmem179b
Mouse Description:
transmembrane protein 179B Gene [Source:MGI Symbol;Acc:MGI:1914956]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa639 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa639
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078694 Nonsense 92 219 2 5
ENSDART00000128424 Nonsense 92 219 2 6
ENSDART00000144180 Nonsense 27 106 1 4

The following transcripts of ENSDARG00000056233 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 21072932)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19663368
GRCz11 7 19915336
KASP Assay ID:
554-0548.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCTGCTTCTCACTCAYTCTCTACTGGATCTACATCGCATTTGTTGAT[G/T]GAGAAATAAAGAGGTATKTCCATAAACACGGTCAGTCACGCGCCGGTGGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link