
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
nme7
- Ensembl ID:
- ENSDARG00000056193
- ZFIN ID:
- ZDB-GENE-000210-35
- Description:
- nucleoside diphosphate kinase 7 [Source:RefSeq peptide;Acc:NP_571004]
- Human Orthologue:
- NME7
- Human Description:
- non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase) [Source:HGNC Symbol;Acc
- Mouse Orthologue:
- Nme7
- Mouse Description:
- non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase) Gene [Source:MGI Symbol
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa33879 | Essential Splice Site | Available for shipment | Available now |
sa40707 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa33879
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000078630 | Essential Splice Site | 128 | 374 | 4 | 12 |
- Genomic Location (Zv9):
- Chromosome 6 (position 28992627)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 29288270 GRCz11 6 29278831 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGATGCCAACCTAATCGTCACCAAAGCCAAAATGACTAAACTTACATGG[T/A]AGGTTTTGCTTAATGATAGCAATGTTGGCAGCAGCCCCTCCGCAAAATTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40707
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000078630 | Nonsense | 340 | 374 | 11 | 12 |
- Genomic Location (Zv9):
- Chromosome 6 (position 28945099)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 29240742 GRCz11 6 29231303 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTTTGTTTCCACACAGGAAATTGCACGCCACCTTCGGCCCAAAACTTTA[C/T]GAGCCCTGTACGGCAAAAACAAACTGCAGAACGGCGTTCACTGCACAGAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- D-dimer levels: Genetic predictors of fibrin D-dimer levels in healthy adults. (View Study)
- Venous thromboembolism: A genome-wide association study of venous thromboembolism identifies risk variants in chromosomes 1q24.2 and 9q. (View Study)
- Venous thromboembolism: Genetics of venous thrombosis: insights from a new genome wide association study. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: