
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-159a18.1
- Ensembl ID:
- ENSDARG00000056145
- ZFIN ID:
- ZDB-GENE-041210-204
- Description:
- Novel protein similar to vertebrate sortilin 1 (SORT1) [Source:UniProtKB/TrEMBL;Acc:Q5RGI7]
- Human Orthologue:
- SORT1
- Human Description:
- sortilin 1 [Source:HGNC Symbol;Acc:11186]
- Mouse Orthologue:
- Sort1
- Mouse Description:
- sortilin 1 Gene [Source:MGI Symbol;Acc:MGI:1338015]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa20265 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa20265
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000078587 | Essential Splice Site | 762 | 805 | 20 | 21 |
ENSDART00000134528 | None | 279 | None | 6 |
- Genomic Location (Zv9):
- Chromosome 4 (position 19046097)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 20122703 GRCz11 4 20111679 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTCTGTATATTACATACTAAAGATTTCTCGTCAACTTCTGCCTCCTGCA[G/A]GTCGCCGGAATATAACTTTTCTGTTCTGCAAATCCAAGAAGACGACCTGT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Chronic kidney disease: New loci associated with kidney function and chronic kidney disease. (View Study)
- Coronary heart disease: A genome-wide association study in Europeans and South Asians identifies five new loci for coronary artery disease. (View Study)
- Coronary heart disease: Large-scale association analysis identifies 13 new susceptibility loci for coronary artery disease. (View Study)
- Lipoprotein-associated phospholipase A2 activity change in response to statin therapy: Genome-wide association study evaluating lipoprotein-associated phospholipase A2 mass and activity at baseline and after rosuvastatin therapy. (View Study)
- Metabolic traits: Genome-wide association analysis of metabolic traits in a birth cohort from a founder population. (View Study)
- Myocardial infarction (early onset): Genome-wide association of early-onset myocardial infarction with single nucleotide polymorphisms and copy number variants. (View Study)
- Progranulin levels: Genome-wide screen identifies rs646776 near sortilin as a regulator of progranulin levels in human plasma. (View Study)
- Response to statin therapy: Genome-wide association of lipid-lowering response to statins in combined study populations. (View Study)
- Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
- Triglycerides: Common variants at 30 loci contribute to polygenic dyslipidemia. (View Study)
- Triglycerides: Large-scale genome-wide association studies in East Asians identify new genetic loci influencing metabolic traits. (View Study)
- Triglycerides: Newly identified loci that influence lipid concentrations and risk of coronary artery disease. (View Study)
- Triglycerides: Six new loci associated with blood low-density lipoprotein cholesterol, high-density lipoprotein cholesterol or triglycerides in humans. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: