zgc:110775

Ensembl ID:
ENSDARG00000056075
ZFIN ID:
ZDB-GENE-050320-60
Description:
hypothetical protein LOC541367 [Source:RefSeq peptide;Acc:NP_001013512]
Human Orthologues:
C4BPA, CD46, CR1, CR1L, CR2
Human Descriptions:
CD46 molecule, complement regulatory protein [Source:HGNC Symbol;Acc:6953]
complement component (3b/4b) receptor 1 (Knops blood group) [Source:HGNC Symbol;Acc:2334]
complement component (3b/4b) receptor 1-like [Source:HGNC Symbol;Acc:2335]
complement component (3d/Epstein Barr virus) receptor 2 [Source:HGNC Symbol;Acc:2336]
complement component 4 binding protein, alpha [Source:HGNC Symbol;Acc:1325]
Mouse Orthologues:
C4bp, Cd46, Cr1l, Cr2, Zp3r
Mouse Descriptions:
CD46 antigen, complement regulatory protein Gene [Source:MGI Symbol;Acc:MGI:1203290]
complement component (3b/4b) receptor 1-like Gene [Source:MGI Symbol;Acc:MGI:88513]
complement component 4 binding protein Gene [Source:MGI Symbol;Acc:MGI:88229]
complement receptor 2 Gene [Source:MGI Symbol;Acc:MGI:88489]
zona pellucida 3 receptor Gene [Source:MGI Symbol;Acc:MGI:104965]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9343 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9343
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054054 Nonsense 213 262 9 13
ENSDART00000103872 Nonsense 335 384 9 13
ENSDART00000133372 Nonsense 335 369 9 12
Genomic Location (Zv9):
Chromosome 23 (position 26391568)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26177688
GRCz11 23 26104229
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTATTTATTTATTTTTCTGTTMMTTTTCTTTCCACAGAAGAAAAATCAT[C/A]ATCGTCTTCCGCACCTCTAGGAGGTGAGTCWTTTTTTTCCATTTGATATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link