
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
hoxb8a
- Ensembl ID:
- ENSDARG00000056027
- ZFIN ID:
- ZDB-GENE-990415-108
- Description:
- Homeobox protein Hox-B8a [Source:UniProtKB/Swiss-Prot;Acc:Q8AWZ0]
- Human Orthologue:
- HOXB8
- Human Description:
- homeobox B8 [Source:HGNC Symbol;Acc:5119]
- Mouse Orthologue:
- Hoxb8
- Mouse Description:
- homeobox B8 Gene [Source:MGI Symbol;Acc:MGI:96189]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa14443 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa14443
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000046638 | Nonsense | 147 | 245 | 2 | 2 |
ENSDART00000123837 | Nonsense | 148 | 246 | 2 | 3 |
- Genomic Location (Zv9):
- Chromosome 3 (position 23980723)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 23558934 GRCz11 3 23689482 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTGTCTAACATCTCTAAACTTCTTTATTGCCAGTAGCTGCCGGACGGAGA[C/T]GAGGCCGTCAGACCTACAGCCGCTATCAGACGCKCGAACTGGARAAAGAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: