si:dkey-47k20.7

Ensembl ID:
ENSDARG00000056014
ZFIN ID:
ZDB-GENE-060503-264
Description:
Novel protein similar to vertebrate pheromone receptor protein [Source:UniProtKB/TrEMBL;Acc:A3QJY4]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32213 Nonsense Available for shipment Available now
sa36687 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32213
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099188 Nonsense 220 831 3 6
ENSDART00000143833 Nonsense 255 866 3 6
Genomic Location (Zv9):
Chromosome 18 (position 31882744)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33679603
GRCz11 18 33654198
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGATATTGTGTTGCTTTTTCTGCAATTCTTCCCCATGACAACAACCAC[A/T]GAGATATTCAACGTATAACAGCCATCATTCAGGCCTCTACAGCTAGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36687
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099188 Nonsense 817 831 6 6
ENSDART00000143833 Nonsense 852 866 6 6
Genomic Location (Zv9):
Chromosome 18 (position 31884924)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33681783
GRCz11 18 33656378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTGGCCATATTTGCACCAAAGTGCTACATCATTCTTTTACATCCAGAG[A/T]GAAACACTAGAAATGCCATAATGGGAAGAGAAATGCAAAATAAATAGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link