v2rh9

Ensembl ID:
ENSDARG00000056009
ZFIN ID:
ZDB-GENE-050419-176
Description:
Novel protein similar to vertebrate phermone receptor protein [Source:UniProtKB/TrEMBL;Acc:A3KQH8]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36685 Nonsense Mutation detected in F1 DNA During 2018
sa5796 Nonsense F2 line generated During 2018
sa2987 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa36685
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022155 Nonsense 166 853 3 6
ENSDART00000131769 Nonsense 105 784 2 5
Genomic Location (Zv9):
Chromosome 18 (position 31697138)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33493997
GRCz11 18 33468592
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTCTGCTATGTTCTTCCTCCTTTGATCACTAATCAGGTTAGTCACTA[T/A]GCTACGTGTTCCTGTTTGAGTGACAGAAAAAAGTACCCCTCTTTCTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5796
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022155 Nonsense 699 853 6 6
ENSDART00000131769 Nonsense 630 784 5 5
ENSDART00000022155 Nonsense 699 853 6 6
ENSDART00000131769 Nonsense 630 784 5 5
Genomic Location (Zv9):
Chromosome 18 (position 31701660)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33498519
GRCz11 18 33473114
KASP Assay ID:
554-3400.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTAGGCCTGAGGGCAAAAAAGCAATGAAATGGTTTGGAGCAGCTCAA[C/T]AAAGATGTACAATTCTGGTCCTAACAGCCATCCAGGTTGTTATATGTGYA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2987
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022155 Nonsense 699 853 6 6
ENSDART00000131769 Nonsense 630 784 5 5
ENSDART00000022155 Nonsense 699 853 6 6
ENSDART00000131769 Nonsense 630 784 5 5
Genomic Location (Zv9):
Chromosome 18 (position 31701660)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33498519
GRCz11 18 33473114
KASP Assay ID:
554-3400.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTAGGCCTGAGGGCAAAAAAGCAATGAAATGGTTTGGAGCAGCTCAA[C/T]AAAGATGTACAATTCTGGTCCTAACAGCCATCCAGGTTGTTATATGTGYA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link