si:dkey-47k20.2

Ensembl ID:
ENSDARG00000056006
ZFIN ID:
ZDB-GENE-060503-735
Description:
Novel protein similar to vertebrate pheromone receptor protein [Source:UniProtKB/TrEMBL;Acc:A3QJY0]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23330 Nonsense Available for shipment Available now
sa25069 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa23330
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059457 Nonsense 111 864 4 8
ENSDART00000135254 Nonsense 109 864 2 6
Genomic Location (Zv9):
Chromosome 18 (position 31786240)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33583099
GRCz11 18 33557694
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGAAATCAATAGGAATCCAAACCTGCTTCCGAACATCACTCTTGGTTA[T/A]TATCTTTATGACAACTGTGTCAAGTTGAGTGTGGCATTCAGGGCTGCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25069
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059457 Nonsense 547 864 7 8
ENSDART00000135254 Nonsense 545 864 5 6
Genomic Location (Zv9):
Chromosome 18 (position 31789252)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33586111
GRCz11 18 33560706
KASP Assay ID:
554-7393.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCCCCCAGGCACCAGACAAGTCAGGAGGAAGGGCCTTCCTGTCTGCTG[T/A]TTTGATTGCCTGCCATGCGCAGATGGAGAGATTTCTAACACAACTGGTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link