v2rh7

Ensembl ID:
ENSDARG00000056000
ZFIN ID:
ZDB-GENE-050419-265
Description:
pheromone receptor [Source:RefSeq peptide;Acc:NP_001119923]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36686 Nonsense Available for shipment Available now
sa43137 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36686
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059412 Nonsense 328 851 3 7
ENSDART00000059462 Nonsense 311 825 3 6
ENSDART00000147592 Nonsense 328 832 3 6
Genomic Location (Zv9):
Chromosome 18 (position 31751477)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33548336
GRCz11 18 33522931
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCGTGGAGAAATCCAGGGCCTTCATAGTTTTCTGTTACGTCTTCATCCC[A/T]AGAGTGACCAAAGAAATAATATAGTGAGGATATTCTGGGAGACCATGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43137
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059412 Essential Splice Site 428 851 3 7
ENSDART00000059462 Essential Splice Site 411 825 3 6
ENSDART00000147592 Essential Splice Site 428 832 3 6
Genomic Location (Zv9):
Chromosome 18 (position 31751780)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33548639
GRCz11 18 33523234
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTCAGTGAGAACAGCTGTGCTGACATAACTGATCTAAAACCCTGGCAG[G/A]TAAGACCCACAGGTACAGTGCAGGGGAATGGAATATGGACAAGCACAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link