v2rh1

Ensembl ID:
ENSDARG00000055994
ZFIN ID:
ZDB-GENE-050419-131
Description:
Novel protein similar to vertebrate phermone receptor protein [Source:UniProtKB/TrEMBL;Acc:A3KQH9]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23328 Essential Splice Site Available for shipment Available now
sa8558 Nonsense Mutation detected in F1 DNA During 2018
sa23329 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23328
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078410 Essential Splice Site 167 846 5 8
ENSDART00000140885 Essential Splice Site 159 855 3 6
Genomic Location (Zv9):
Chromosome 18 (position 31719680)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33516539
GRCz11 18 33491134
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTTTAACATTTTCTTTCATCTGTTCTGCCCTAAATCTTTTCTAATTA[G/A]ATTAGCTACTACGCCACTTGCTCTTGTTTAAGTGACAAGAAAAAGTACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078410 Nonsense 401 846 5 8
ENSDART00000140885 Nonsense 393 855 3 6
Genomic Location (Zv9):
Chromosome 18 (position 31720385)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33517244
GRCz11 18 33491839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCATCACAAACACACCTTWCACTGATGTTTCAGGTTTGAGGGCACCTTA[T/G]AATGTGTATAAAGCAGTTTATGCCCTGGCCCATGCACTTCATGACCTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23329
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078410 Nonsense 598 846 8 8
ENSDART00000140885 Nonsense 597 855 6 6
Genomic Location (Zv9):
Chromosome 18 (position 31721380)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33518239
GRCz11 18 33492834
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCATATGAAGATCCTCTAGGCATCTCTCTGACCACTGCTTCCCTGCTA[G/T]GAACCTGCTTCTGTGCTCTTGTGATGATAATCTTTGCTTTTCATCATAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link