v2rh12

Ensembl ID:
ENSDARG00000055983
ZFIN ID:
ZDB-GENE-050419-86
Description:
Novel protein similar to vertebrate phermone receptor protein [Source:UniProtKB/TrEMBL;Acc:A3KQH5]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10737 Essential Splice Site Available for shipment Available now
sa23327 Nonsense Available for shipment Available now
sa29061 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10737
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007035 Essential Splice Site 153 850 3 6
ENSDART00000141838 Essential Splice Site 172 867 3 6
Genomic Location (Zv9):
Chromosome 18 (position 31615890)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33412749
GRCz11 18 33387344
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTCATCTGACTAACACTTAATCTGTTCTGCCCTATATATTTTCTAATT[A/G]GATAAGCTACTACGCCACTTGCTCTTGTTTAAGTGACAAKAAAAAGTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23327
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007035 Nonsense 359 850 3 6
ENSDART00000141838 Nonsense 378 867 3 6
Genomic Location (Zv9):
Chromosome 18 (position 31616510)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33413369
GRCz11 18 33387964
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGTTTGGGTGCAGTTTTGAAACTGGGGATAAAGAGACATTTGGGCAA[C/T]AAATGAAAAAGGTGTGTACAGGACTGGAGGATCTGAGCACTGCAAACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29061
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007035 Nonsense 628 850 6 6
ENSDART00000141838 Nonsense 645 867 6 6
Genomic Location (Zv9):
Chromosome 18 (position 31617629)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33414488
GRCz11 18 33389083
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTACGTGCCAACAATTCAGAGCTCAGCTTCCTGCTGCTTTTGTCACTC[A/T]AACTGTGTTTCCTGTGTGTGCTGCTGTTCATTGGTCAGCCCCAGTTGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link