zgc:136971

Ensembl ID:
ENSDARG00000055970
ZFIN ID:
ZDB-GENE-060421-3674
Description:
hypothetical protein LOC678599 [Source:RefSeq peptide;Acc:NP_001035437]
Human Orthologue:
APEH
Human Description:
N-acylaminoacyl-peptide hydrolase [Source:HGNC Symbol;Acc:586]
Mouse Orthologue:
Apeh
Mouse Description:
acylpeptide hydrolase Gene [Source:MGI Symbol;Acc:MGI:88041]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21308 Nonsense Available for shipment Available now
sa14311 Nonsense Available for shipment Available now
sa27217 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21308
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078369 Nonsense 290 714 10 22
ENSDART00000131925   None 199 None 8
ENSDART00000138725   None 42 None 2
Genomic Location (Zv9):
Chromosome 8 (position 27289646)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26417564
GRCz11 8 26436703
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCTGATGGCATGTCTGTGTCAAGCCCTCGAATGAGTCCAGACTCGTG[T/A]TGGATCGTCTACTTACAGGGAGAAGTGTTTGGACCACATCATCAGTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14311
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078369 Nonsense 338 714 12 22
ENSDART00000131925   None 199 None 8
ENSDART00000138725   None 42 None 2
Genomic Location (Zv9):
Chromosome 8 (position 27291385)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26419303
GRCz11 8 26438442
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTCATGTGAGTRACTTNNCTTCCTCTCTCAGGCCAGTTTGCCGGTATATA[T/A]GAGTCSCTACCWTCAYATTGCTGGTCTGCAGACAGTGAGAGAGTCTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27217
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078369 Essential Splice Site 517 714 17 22
ENSDART00000131925   None 199 None 8
ENSDART00000138725   None 42 None 2
Genomic Location (Zv9):
Chromosome 8 (position 27297707)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26425625
GRCz11 8 26444764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGCCACAGCCGCTGCTTTAACCAAATTGGGCTTTGCCGTTCTTATGGG[T/A]GAGTCTTTAAATGTCATTCTAGTTCCTCTGACAACATTAAAAGCAGAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link