zgc:101809

Ensembl ID:
ENSDARG00000055955
ZFIN ID:
ZDB-GENE-041114-97
Description:
lymphocyte cytosolic protein 2 [Source:RefSeq peptide;Acc:NP_999882]
Human Orthologue:
LCP2
Human Description:
lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa) [Source:HGNC Symbo
Mouse Orthologue:
Lcp2
Mouse Description:
lymphocyte cytosolic protein 2 Gene [Source:MGI Symbol;Acc:MGI:1321402]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43670 Essential Splice Site Mutation detected in F1 DNA During 2018
sa37342 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43671 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31060 Essential Splice Site Mutation detected in F1 DNA During 2018
sa1278 Essential Splice Site Available for shipment Available now
sa29621 Essential Splice Site Mutation detected in F1 DNA During 2018
sa23970 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa43670
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059420 Essential Splice Site 48 501 3 21
ENSDART00000145050 Essential Splice Site 48 500 3 19
Genomic Location (Zv9):
Chromosome 21 (position 29056640)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30275884
GRCz11 21 30312579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCACCGTATATATGCAATCTTATGATGATAAAATACGTTTTTTTCCTC[A/T]GAATATGTCTGAAAATGACCTTCGAAGGTTTCCACAGCTTCATGCACCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37342
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059420 Essential Splice Site 171 501 7 21
ENSDART00000145050 Essential Splice Site 171 500 7 19
Genomic Location (Zv9):
Chromosome 21 (position 29072287)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30291531
GRCz11 21 30328226
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGCCCAGATCTGTCCTGCTAAACCCATGGACAACTGTGATTACATTGG[T/C]ACACACAAATGAACAGTTTTCAGTCTTGTGGTCATTGGAGTCTATTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43671
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059420 Essential Splice Site 203 501 8 21
ENSDART00000145050 Essential Splice Site 203 500 8 19
ENSDART00000059420 Essential Splice Site 203 501 8 21
ENSDART00000145050 Essential Splice Site 203 500 8 19
Genomic Location (Zv9):
Chromosome 21 (position 29072466)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30291710
GRCz11 21 30328405
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCGACCAGGCCCTGGACCCTCAGTGCCCCCTGTAGACCGGCCAAGTG[T/C]GAGTCCTTCATATTTCCAAACAGTATGTGGCCGTCTTTGCCTCTAATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31060
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059420 Essential Splice Site 203 501 8 21
ENSDART00000145050 Essential Splice Site 203 500 8 19
ENSDART00000059420 Essential Splice Site 203 501 8 21
ENSDART00000145050 Essential Splice Site 203 500 8 19
Genomic Location (Zv9):
Chromosome 21 (position 29072466)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30291710
GRCz11 21 30328405
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCGACCAGGCCCTGGACCCTCAGTGCCCCCTGTAGACCGGCCAAGTG[T/C]GAGTCCTTCATATTTCCAAACAGTATGTGGCCGTCTTTGCCTCTAATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1278
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059420 Essential Splice Site 223 501 10 21
ENSDART00000145050 Essential Splice Site 223 500 10 19
Genomic Location (Zv9):
Chromosome 21 (position 29077223)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30296467
GRCz11 21 30333162
KASP Assay ID:
554-1193.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGAAATGTTGTTGTTGAAGTTACCCAGTAAACAATGYTGTTTTTACTCC[A/T]GCACCAGCTGTGGACCGCAGTAAAAAACCAGGAACTTTGGATAGAATTCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa29621
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059420 Essential Splice Site 254 501 11 21
ENSDART00000145050 Essential Splice Site 254 500 11 19
Genomic Location (Zv9):
Chromosome 21 (position 29077510)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30296754
GRCz11 21 30333449
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAACTGACTGTCTTCACAGGAGGAAGAGGAACTAGCTCACTTGATAGA[G/A]TAAGTTTGGTTTGTTCTGTCTTTATTTCACACAAATTGTTCTGAATAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23970
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059420 Essential Splice Site 363 501 17 21
ENSDART00000145050 Essential Splice Site 362 500 15 19
Genomic Location (Zv9):
Chromosome 21 (position 29083879)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30303123
GRCz11 21 30339818
KASP Assay ID:
2261-5779.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACGCAGCGTTAATCCCAGTCGATCACTACCGGCTAAACTGCAGGAGG[G/A]TAAGCTAAGCACACATTACACTAGTTTGATGAAATCTTCATTCAGTCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link