asph

Ensembl ID:
ENSDARG00000055945
ZFIN ID:
ZDB-GENE-031112-5
Description:
Aspartate beta-hydroxylase [Source:UniProtKB/TrEMBL;Acc:B0S5J6]
Human Orthologue:
ASPH
Human Description:
aspartate beta-hydroxylase [Source:HGNC Symbol;Acc:757]
Mouse Orthologue:
Asph
Mouse Description:
aspartate-beta-hydroxylase Gene [Source:MGI Symbol;Acc:MGI:1914186]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30821 Nonsense Mutation detected in F1 DNA During 2018
sa32929 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30821
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099208 Nonsense 72 472 3 10
ENSDART00000121670 Nonsense 72 443 3 7
ENSDART00000133202 Nonsense 72 183 3 5

The following transcripts of ENSDARG00000055945 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26810473)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27006669
GRCz11 2 26662303
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATATCTGGCCTTAATTTGCATGCAGCCAAAGCAAAGGACTTGCGCTA[T/G]AATCTTTCAGAGGTATTACAAGGTATGACATCTAAACTGGTGGTTATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32929
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099208 Nonsense 352 472 7 10
ENSDART00000121670 Nonsense 352 443 7 7
ENSDART00000133202   None 183 None 5

The following transcripts of ENSDARG00000055945 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26825468)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27021664
GRCz11 2 26677298
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATGAAGTTGAGGAAAATTTACCAGTAGAAGAACCAGTGGAGGATCTT[G/T]AACCGGTAGAAGAACCAGTGGAGGAAACTGAACAAGTAGAAGAAGCATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link