ZC3H7B (1 of 3)

Ensembl ID:
ENSDARG00000055930
Description:
zinc finger CCCH-type containing 7B [Source:HGNC Symbol;Acc:30869]
Human Orthologue:
ZC3H7B
Human Description:
zinc finger CCCH-type containing 7B [Source:HGNC Symbol;Acc:30869]
Mouse Orthologue:
Zc3h7b
Mouse Description:
zinc finger CCCH type containing 7B Gene [Source:MGI Symbol;Acc:MGI:1328310]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13447 Nonsense Available for shipment Available now
sa35262 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13447
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078337 Nonsense 31 904 2 21
Genomic Location (Zv9):
Chromosome 12 (position 20280701)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19062545
GRCz11 12 19184419
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCTTTTTGCCACAGGTCATCTTTGCCTTTTCCCGAACCTGAAGGTTA[T/A]GAGGTATGACTTACTTGTATTATCCCTTAAGAAAAAATGCCCCACCTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35262
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078337 Nonsense 895 904 21 21
Genomic Location (Zv9):
Chromosome 12 (position 20255836)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19037680
GRCz11 12 19159554
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGACATGTCTAATGGTTAAATTTATCTTCGTTCTTTCTGACAGGTTGGA[C/T]GACGGATGTCTGGTGGTGGAGGAGACCTGTGACCAGTCCAAAAGTGTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link