si:dkey-47k20.9

Ensembl ID:
ENSDARG00000055920
ZFIN ID:
ZDB-GENE-060503-454
Description:
Novel protein similar to vertebrate pheromone receptor protein [Source:UniProtKB/TrEMBL;Acc:A3QJY6]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa392 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa392
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078331 Nonsense 28 846 1 7
ENSDART00000145000 Nonsense 47 866 1 6
Genomic Location (Zv9):
Chromosome 18 (position 31913832)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33710691
GRCz11 18 33685286
KASP Assay ID:
554-0254.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGGAGTTTTAAGTTGAATGGAATGTACCAGGATGGAGATTTTATACTC[G/T]GAGGCCTATTTGAGGTTCACTTCTTTACAGTGTTTCCAGATCTGACTTTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link