si:dkey-53p21.1

Ensembl ID:
ENSDARG00000055901
ZFIN ID:
ZDB-GENE-070424-244
Description:
hypothetical protein LOC550429 [Source:RefSeq peptide;Acc:NP_001017734]
Human Orthologue:
STEAP4
Human Description:
STEAP family member 4 [Source:HGNC Symbol;Acc:21923]
Mouse Orthologue:
Steap4
Mouse Description:
STEAP family member 4 Gene [Source:MGI Symbol;Acc:MGI:1923560]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39102 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39102
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078310 Nonsense 263 464 3 5
ENSDART00000129317 Nonsense 271 472 2 4
ENSDART00000145198 Nonsense 271 472 3 5
Genomic Location (Zv9):
Chromosome 16 (position 29968599)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27805737
GRCz11 16 27740360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGCCCTCTGTTACCTGCCGGGAGCTTTGGCAGGATTCCTGCAGCTTTA[T/G]AATGGCACCAAGTACCGTCGTTTCCCAGATTGGTTAGATCGCTGGATGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link