zgc:153215

Ensembl ID:
ENSDARG00000055889
ZFIN ID:
ZDB-GENE-061103-58
Description:
hypothetical protein LOC777631 [Source:RefSeq peptide;Acc:NP_001071207]
Human Orthologue:
RBM12B
Human Description:
RNA binding motif protein 12B [Source:HGNC Symbol;Acc:32310]
Mouse Orthologues:
C430048L16Rik, Rbm12b
Mouse Descriptions:
RIKEN cDNA C430048L16 gene Gene [Source:MGI Symbol;Acc:MGI:1924854]
RNA binding motif protein 12B Gene [Source:MGI Symbol;Acc:MGI:1919647]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa910 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa910
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078297 Nonsense 459 523 2 2
ENSDART00000142102   None 151 None 2
Genomic Location (Zv9):
Chromosome 16 (position 29790649)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27627787
GRCz11 16 27562410
KASP Assay ID:
554-0817.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCCAGCAGATGTCAGGAAAGAGGAGGTGAAAGGTTTTTTCATGCCCTA[T/G]AATATCGGTGATGATGCAGTCAGATTGCTTGTGGACAACCAAGGCAATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link