zgc:194342

Ensembl ID:
ENSDARG00000055856
ZFIN ID:
ZDB-GENE-080723-36
Description:
hypothetical protein LOC100170794 [Source:RefSeq peptide;Acc:NP_001124104]
Human Orthologues:
TOR1A, TOR1B
Human Descriptions:
torsin family 1, member A (torsin A) [Source:HGNC Symbol;Acc:3098]
torsin family 1, member B (torsin B) [Source:HGNC Symbol;Acc:11995]
Mouse Orthologues:
Tor1a, Tor1b
Mouse Descriptions:
torsin family 1, member A (torsin A) Gene [Source:MGI Symbol;Acc:MGI:1353568]
torsin family 1, member B Gene [Source:MGI Symbol;Acc:MGI:1353605]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44040 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44040
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078253 Essential Splice Site 197 323 3 5
Genomic Location (Zv9):
Chromosome 23 (position 37631019)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 37430247
GRCz11 23 37532909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAATGTGGATGGAGTATCATTTCACACTGCGATCTTCATTTTTCTAAG[G/A]TAATGCACTAAAATGTTACTGTCAGATCCAAATGGAGTCCAGACTCCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link