zgc:136551

Ensembl ID:
ENSDARG00000055837
ZFIN ID:
ZDB-GENE-060616-136
Description:
hypothetical protein LOC557983 [Source:RefSeq peptide;Acc:NP_001038313]
Human Orthologue:
ARHGEF1
Human Description:
Rho guanine nucleotide exchange factor (GEF) 1 [Source:HGNC Symbol;Acc:681]
Mouse Orthologue:
Arhgef1
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI Symbol;Acc:MGI:1353510]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36146 Nonsense Mutation detected in F1 DNA During 2018
sa36145 Nonsense Mutation detected in F1 DNA During 2018
sa44852 Nonsense Mutation detected in F1 DNA During 2018
sa22852 Nonsense Available for shipment Available now
sa22851 Nonsense Available for shipment Available now
sa9929 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36146
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087624 Nonsense 139 433 7 20
ENSDART00000124618 Nonsense 139 1005 6 30
ENSDART00000139355 Nonsense 139 1005 7 31
Genomic Location (Zv9):
Chromosome 16 (position 28430588)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26306362
GRCz11 16 26179804
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGATCGCTTGCGTCCAGAACTGATCAATGAAGAGCAGCAAAAACGTTA[C/A]GCTAATGAAATACAGTTTGCGCAGAGTCCAGAGATACTGCGACAGCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36145
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087624 Nonsense 147 433 7 20
ENSDART00000124618 Nonsense 147 1005 6 30
ENSDART00000139355 Nonsense 147 1005 7 31
Genomic Location (Zv9):
Chromosome 16 (position 28430566)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26306340
GRCz11 16 26179782
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATCAATGAAGAGCAGCAAAAACGTTACGCTAATGAAATACAGTTTGCG[C/T]AGAGTCCAGAGATACTGCGACAGCTGGAAGACTTCAGGTGAGAGTTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44852
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087624 Nonsense 180 433 8 20
ENSDART00000124618 Nonsense 180 1005 7 30
ENSDART00000139355 Nonsense 180 1005 8 31
Genomic Location (Zv9):
Chromosome 16 (position 28430381)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26306155
GRCz11 16 26179597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGGGAATGACACCTAATGAGCGGGAATTAAATGATGTGGAATCCCAT[C/T]GACCCACTGATCGCATCCCTATGGACATGAAGGAGAAGGCTGTCGCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22852
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087624   None 433 17 20
ENSDART00000124618 Nonsense 459 1005 15 30
ENSDART00000139355 Nonsense 459 1005 16 31
Genomic Location (Zv9):
Chromosome 16 (position 28407891)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26283665
GRCz11 16 26157107
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGAAATAATTGTTTCCTGTCGTTCTCCCAGAGCTGTTTGTGACAGAA[C/T]AAGCACACGTCCGTATGCTGAGTGTATTGCAGACAGTGTTTTCTCGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22851
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087624   None 433 20 20
ENSDART00000124618 Nonsense 583 1005 18 30
ENSDART00000139355 Nonsense 583 1005 19 31
Genomic Location (Zv9):
Chromosome 16 (position 28404394)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26280168
GRCz11 16 26153610
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTGTTTGTTTTTAGGAAGCAGAGAGTAAGCCACAGTGTCGGAGGCTA[C/T]AGCTAAAGGATATCATACCCATAGAGATGCAGAGACTAACAAAATACCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9929
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087624   None 433 None 20
ENSDART00000124618 Nonsense 842 1005 26 30
ENSDART00000139355 Nonsense 842 1005 27 31
Genomic Location (Zv9):
Chromosome 16 (position 28397596)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26273370
GRCz11 16 26146812
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTCGGTGTTGTGTTTTTATTCTGAATTGTGGTTTACTTCACCCCAGGG[C/T]GATTTAGTGAGAAGATTCGRGAAAGTGATCCTCCACTCATCGACTATCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link