heyl

Ensembl ID:
ENSDARG00000055798
ZFIN ID:
ZDB-GENE-030131-7074
Description:
Hairy/enhancer-of-split related with YRPW motif-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q8AXV5
Human Orthologue:
HEYL
Human Description:
hairy/enhancer-of-split related with YRPW motif-like [Source:HGNC Symbol;Acc:4882]
Mouse Orthologue:
Heyl
Mouse Description:
hairy/enhancer-of-split related with YRPW motif-like Gene [Source:MGI Symbol;Acc:MGI:1860511]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44920 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44920
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078197 Essential Splice Site 104 310 4 5
Genomic Location (Zv9):
Chromosome 19 (position 33932601)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 32970017
GRCz11 19 32557137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGATGACAGTGGATCATCTCAAACTGCTGCATGCCATGGGTGGCAAAG[G/A]TGAGAGGAGACACTGATCCGGGAACTTTCATTAGGGTGTTATACTGTTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link