zgc:158423

Ensembl ID:
ENSDARG00000055791
ZFIN ID:
ZDB-GENE-061215-58
Description:
hypothetical protein LOC790938 [Source:RefSeq peptide;Acc:NP_001073552]
Human Orthologue:
SLC3A2
Human Description:
solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 [Source:H
Mouse Orthologue:
Slc3a2
Mouse Description:
solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 Gene [Sou

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34044 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34044
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078181 Essential Splice Site None 480 1 9

The following transcripts of ENSDARG00000055791 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 21693488)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20283924
GRCz11 7 20535892
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTAGTGTTCTGCCCGACAACACAGAGGAGAACTCAGCTAAACTAAAG[G/A]TATTTAACCATGCATTCTTCTTTTTGTATTAAGCCATTGATTTATTGGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link