zgc:123116

Ensembl ID:
ENSDARG00000055787
ZFIN ID:
ZDB-GENE-051113-296
Description:
hypothetical protein LOC407652 [Source:RefSeq peptide;Acc:NP_001038395]
Human Orthologue:
C20orf12
Human Description:
chromosome 20 open reading frame 12 [Source:HGNC Symbol;Acc:15858]
Mouse Orthologue:
6330439K17Rik
Mouse Description:
RIKEN cDNA 6330439K17 gene Gene [Source:MGI Symbol;Acc:MGI:2139080]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29799 Nonsense Mutation detected in F1 DNA During 2018
sa24186 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa29799
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078173 Nonsense 224 752 8 21
Genomic Location (Zv9):
Chromosome 22 (position 25526694)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 25026600
GRCz11 22 25054224
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTAAAGATGTCCTAAGTGCCTTAGCCATCGACCTTCAGACCCTTTTGCC[C/T]GATTCTGTCTGCATTGTGGAGCGCCAGTCCCTCCAATACCTGGTCAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24186
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078173 Essential Splice Site 513 752 14 21
Genomic Location (Zv9):
Chromosome 22 (position 25531302)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 25031208
GRCz11 22 25058832
KASP Assay ID:
2261-6911.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATAATACTGAGTTCAGAGCTCTGATTGGAGAACCTCGGCTGGGCAGAG[T/A]AAGAATTTTCCAGTCCACAAAAATGTATATTAATACTACTAATAAATAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link