tmem9

Ensembl ID:
ENSDARG00000055757
ZFIN ID:
ZDB-GENE-030131-6083
Description:
transmembrane protein 9 [Source:RefSeq peptide;Acc:NP_956160]
Human Orthologue:
TMEM9
Human Description:
transmembrane protein 9 [Source:HGNC Symbol;Acc:18823]
Mouse Orthologue:
Tmem9
Mouse Description:
transmembrane protein 9 Gene [Source:MGI Symbol;Acc:MGI:1913491]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34410 Splice Site, Nonsense Mutation detected in F1 DNA During 2018
sa34411 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34410
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062403 Splice Site, Nonsense 38 193 1 5
ENSDART00000137899 Splice Site, Nonsense 31 186 2 6
Genomic Location (Zv9):
Chromosome 8 (position 26614992)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25742910
GRCz11 8 25762049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGGCGTTTCTTGTTCTCATAGAAGTGGTGTCGTTTGCTTCTGCAGAT[A/T]AGGTACAGTTTTACTGGCTTATTTTCACCTGTATTCTTATGTTTTAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34411
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062403 Essential Splice Site 105 193 3 5
ENSDART00000137899 Essential Splice Site 98 186 4 6
Genomic Location (Zv9):
Chromosome 8 (position 26617019)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25744937
GRCz11 8 25764076
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGCTGTGTGAGTGCAAGTATGAAGAACGAAGCAGCAACACCATCAAG[G/A]TGAGAAGAGACTTTTATTATCTAATCATGCATTTAAAGGAAATTGAGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link