smc1a

Ensembl ID:
ENSDARG00000055754
ZFIN ID:
ZDB-GENE-090506-9
Description:
structural maintenance of chromosomes protein 1A [Source:RefSeq peptide;Acc:NP_001155103]
Human Orthologue:
SMC1A
Human Description:
structural maintenance of chromosomes 1A [Source:HGNC Symbol;Acc:11111]
Mouse Orthologue:
Smc1a
Mouse Description:
structural maintenance of chromosomes 1A Gene [Source:MGI Symbol;Acc:MGI:1344345]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32449 Nonsense Available for shipment Available now
sa32450 Nonsense Available for shipment Available now
sa44003 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32449
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078148 Nonsense 3 1232 1 26
Genomic Location (Zv9):
Chromosome 23 (position 28936224)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28766791
GRCz11 23 28693332
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCGCATCTAACACGCCCCTCTCTGAACAATCAGACAGTATGGGATA[T/A]TTAAAACTAATCGAGATCGAAAATTTCAAATCATATAAAGGACGCCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32450
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078148 Nonsense 436 1232 8 26
Genomic Location (Zv9):
Chromosome 23 (position 28941781)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28772348
GRCz11 23 28698889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAAATAAAGCAGAAGATCCGAGAGATTGAAGAAAACCAGAAGCGTATT[G/T]AAAAGCTGGAGGACTATATTGCAACCAGCAGGTATTTTAGTGAACATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44003
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078148 Nonsense 753 1232 15 26
Genomic Location (Zv9):
Chromosome 23 (position 28949022)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28779589
GRCz11 23 28706130
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGGAGAGCGAGCTGGCAAATTTTGGTCCACGAATCAATGACATCAAA[C/T]GAATCATCCAATCACGAGAGAGGGACATAACACAGCTAAGAGATCGTATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link