suv39h1b

Ensembl ID:
ENSDARG00000055753
ZFIN ID:
ZDB-GENE-030131-5105
Description:
histone-lysine N-methyltransferase SUV39H1 [Source:RefSeq peptide;Acc:NP_001119954]
Human Orthologue:
SUV39H1
Human Description:
suppressor of variegation 3-9 homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:11479]
Mouse Orthologue:
Suv39h1
Mouse Description:
suppressor of variegation 3-9 homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1099440]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31658 Nonsense Available for shipment Available now
sa21303 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31658
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078152 Nonsense 32 421 2 6

The following transcripts of ENSDARG00000055753 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 26612473)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25740391
GRCz11 8 25759530
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTACGACAGAGCAGCTGGAGGTGGTCTGTCGAGATGAGGGAGTGGTGTG[C/A]GAAGAGCTCGGCATCAGCAGGAACAACCTGTGTGATTATGAAGTGGAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21303
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078152 Nonsense 272 421 3 6

The following transcripts of ENSDARG00000055753 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 26609533)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25737451
GRCz11 8 25756590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTTTCAGGACGGACAATGGCAGGGGATGGGGAGTGCGGACCATGGAG[C/T]GAATTCGCAAGAACACTTTCGTCATGGAGTATGTCGGCGAGGTGAGAGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link