ankrd54

Ensembl ID:
ENSDARG00000055743
ZFIN ID:
ZDB-GENE-040718-318
Description:
Ankyrin repeat domain-containing protein 54 [Source:UniProtKB/Swiss-Prot;Acc:Q6DGX3]
Human Orthologue:
ANKRD54
Human Description:
ankyrin repeat domain 54 [Source:HGNC Symbol;Acc:25185]
Mouse Orthologue:
Ankrd54
Mouse Description:
ankyrin repeat domain 54 Gene [Source:MGI Symbol;Acc:MGI:2444209]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31331 Nonsense Available for shipment Available now
sa31330 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31331
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078137 Nonsense 224 315 6 8
Genomic Location (Zv9):
Chromosome 3 (position 26995711)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25908525
GRCz11 3 26039396
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTCTGAATGTCTCTTTAGGTGCTCGTGTTGATGCTCTGGATCGTGCT[G/T]GAAGGACTCCTCTCCATCTCGCCCGCTCCAAGCTCAACATCTTGCAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31330
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078137 Essential Splice Site 291 315 7 8
Genomic Location (Zv9):
Chromosome 3 (position 26992455)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25911781
GRCz11 3 26042652
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTAGAGCACATCTCAACCCAGCTGCAGAACACCCGCACCAGAGAACAGG[T/G]AAACACACACATCTGAGATCTAACACAGCCCTTTAATAATGTACAAACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link